Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

HLTUD002C

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor

cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences

Synonyme(s) :

Tough Decoy, TuD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41106609
Nomenclature NACRES :
NA.51

Gamme de produits

MISSION®

Forme

liquid

Concentration

≥1x106 VP/ml (via p24 assay)

Séquence mature

CGGUACGAUCGCGGCGGGAUAUC

Numéro d'accès Sanger mature/mineur

MIMAT0000299

Numéro d'accès Sanger microARN

MI0000319

Conditions d'expédition

dry ice

Température de stockage

−70°C

Vous recherchez des produits similaires ? Visite Guide de comparaison des produits

Description générale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Autres remarques

Based on miRBase V19 Mature ID

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 3

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ruben Aquino-Martinez et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(1), 135-144 (2018-10-16)
Developing novel approaches to treat skeletal disorders requires an understanding of how critical molecular factors regulate osteoblast differentiation and bone remodeling. We have reported that (1) retinoic acid receptor-related orphan receptor beta (Rorβ) is upregulated in bone samples isolated from
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique