HMI0434
MISSION® microRNA Mimic
hsa-miR-29a
Sinônimo(s):
hsa-miR-29a-3p
Faça loginpara ver os preços organizacionais e de contrato
About This Item
Produtos recomendados
linha de produto
MISSION®
Formulário
solid
sequência madura
UAGCACCAUCUGAAAUCGGUUA
nº de adesão de Sanger principal/secundário
nº de adesão de microRNA de Sanger
temperatura de armazenamento
−20°C
Informações sobre genes
Descrição geral
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Outras notas
miRBase V18 Mature ID update: hsa-miR-29a-3p
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de classe de armazenamento
11 - Combustible Solids
Classe de risco de água (WGK)
WGK 3
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Escolha uma das versões mais recentes:
Certificados de análise (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Se precisar de ajuda, entre em contato Atendimento ao cliente
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Mengxing Ouyang et al.
Scientific reports, 7, 44757-44757 (2017-03-21)
Successful developments of new therapeutic strategies often rely on the ability to deliver exogenous molecules into cytosol. We have developed a versatile on-chip vortex-assisted electroporation system, engineered to conduct sequential intracellular delivery of multiple molecules into various cell types at
Minfei Jin et al.
Stem cell research & therapy, 7(1), 167-167 (2016-11-20)
Pelvic floor dysfunction (PFD) is a condition affecting many women worldwide, with symptoms including stress urinary incontinence (SUI) and pelvic organ prolapse (POP). We have previously demonstrated stable elastin-expressing bone marrow-derived mesenchymal stem cells (BMSCs) attenuated PFD in rats, and
Active Filters
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica
