Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU216481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcan

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCATAGCAAGCCCAGAGCAGCTGTTTGCCGCCTATGAGGATGGATTTGAGCAGTGTGATGCAGGATGGCTGTCTGATCAAACTGTCAGATATCCCATACGGGCTCCCCGAGAGGGCTGTTACGGAGACATGATGGGGAAGGAAGGGGTTCGGACCTATGGATTCCGCTCTCCCCAGGAAACCTATGATGTGTATTGTTATGTGGATCATCTGGATGGCGATGTGTTCCACATCACTGCTCCCAGTAAGTTCACCTTCGAGGAGGCCGAAGCAGAGTGTACAAGCAGGGATGCGAGGCTGGCGACTGTTGGAGAACTTCAGGCAGCTTGGAGAAATGGCTTTGACCAATGCGATTACGGCTGGCTGTCGGATGCCAGCGTGCGGCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGAGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000021614

nº de adesão NCBI

NM_019389

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... VCAN(13003) , Vcan(13003)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zi Wang et al.
Oncology reports, 33(6), 2981-2991 (2015-04-16)
The systematic application of antiangiogenic therapy remains an issue of concern, mainly due to the hypoxic and inflammatory changes in the tumor microenvironment elicited by antiangiogenic therapy. Versican, a 'bridge' connecting inflammation with tumor progression as well as playing a
Lu-lu Xu et al.
Respiratory physiology & neurobiology, 215, 58-63 (2015-05-23)
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown
Pamela A Havre et al.
BMC cancer, 13, 517-517 (2013-11-05)
CD26/dipeptidyl peptidase IV (DPPIV) is a multifunctional membrane protein with a key role in T-cell biology and also serves as a marker of aggressive cancers, including T-cell malignancies. Versican expression was measured by real-time RT-PCR and Western blots. Gene silencing
Jon M Carthy et al.
Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology, 24(6), 368-374 (2015-09-24)
Versican is a versatile and highly interactive chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of many tissues and is a major component of developing and developed lesions in atherosclerotic vascular disease. In this paper, we present
Naoko Arichi et al.
Oncoscience, 2(2), 193-204 (2015-04-11)
In the current study, we investigated a combination of docetaxel and thalidomide (DT therapy) in castration-resistant prostate cancer (CRPC) patients. We identified marker genes that predict the effect of DT therapy. Using an androgen-insensitive PC3 cell line, we established a
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica