Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU093981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bmi1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAATCTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAGGACTGTTAAGGAAAAGATTTTTCAACCCCCTGATTTAGTTACCTTCATTCATTACAGCTTTATAGATGCTTAATACATGTGACTGTCGTCCAGTTTGCTTCCTTTTGTAGTGACTTTAAATTTGGCCATAAATGATGGACTAGATGTGATACTTCATATGGATGTTAAGTGGAAAGATTGATTCTTTCTCTAAAGAATTGGATTCTGAGAAGGATTCTGTGTTAGGAAAGATGTGAAATGATTTCTGTGACCACTGTTTGGATCTGGAAATGTTCTACAGTGGGTAGACATTGGGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000026739

nº de adesão NCBI

NM_007552

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... BMI1(12151) , Bmi1(12151)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
SUU
KTU
PGT
WFT
FXS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dan Xiong et al.
Cancer biology & therapy, 16(5), 756-763 (2015-04-17)
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we
Boyang Chang et al.
Biochimica et biophysica acta, 1840(12), 3285-3291 (2014-08-26)
Bmi-1 had been found to involve in self renewal of stem cells and tumorigenesis in various malignancies. In this study, we investigated the role of Bmi-1 in the development of salivary adenoid cystic carcinoma (SACC). At first, we confirmed that
Lei Liu et al.
International journal of clinical and experimental pathology, 8(6), 6674-6682 (2015-08-12)
The aim of this study was to evaluate the efficiency of a targeted siRNA nano-delivery system to silence the expression of Bmi-1 and hTERT, and to verify the toxicity of this delivery system in MCF-7 breast cancer cells. The most
F Wei et al.
Oncogene, 34(23), 3063-3075 (2014-08-05)
The BMI1 protein contributes to stem cell pluripotency and oncogenesis via multiple functions, including its newly identified role in DNA damage response (DDR). Although evidence clearly demonstrates that BMI1 facilitates the repair of double-stranded breaks via homologous recombination (HR), it

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica