Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU082841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfe2l2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGAGAACATTGTCGAGCTGGAGCAAGACTTGGGCCACTTAAAAGACGAGAGAGAAAAACTACTCAGAGAAAAGGGAGAAAACGACAGAAACCTCCATCTACTGAAAAGGCGGCTCAGCACCTTGTATCTTGAAGTCTTCAGCATGTTACGTGATGAGGATGGAAAGCCTTACTCTCCCAGTGAATACTCTCTGCAGCAAACCAGAGATGGCAATGTGTTCCTTGTTCCCAAAAGCAAGAAGCCAGATACAAAGAAAAACTAGGTTCGGGAGGATGGAGCCTTTTCTGAGCTAGTGTTTGTTTTGTACTGCTAAAACTTCCTACTGTGATGTGAAATGCAGAAACACTTTATAAGTAACTATGCAGAATTATAGCCAAAGCTAGTATAGCAATAATATGAAACTTTACAAAGCATTAAAGTCTCAATGTTGAATCAGTTTCATTTTAACTCTCAAGTTAATTTCTTAGGCACCATTTGGGAG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian-ping Li et al.
Acta pharmacologica Sinica, 35(8), 1031-1044 (2014-07-01)
To investigate the anti-fibrosis effects of ginsenoside Rg1 on alcohol- and CCl4-induced hepatic fibrosis in rats and to explore the mechanisms of the effects. Rats were given 6% alcohol in water and injected with CCl4 (2 mL/kg, sc) twice a
Jie Zhou et al.
PloS one, 9(7), e101668-e101668 (2014-07-06)
Salvianolic acid B (SalB), a bioactive compound isolated from the plant-derived medicinal herb Danshen, has been shown to exert various anti-oxidative and anti-inflammatory activities in several neurological disorders. In this study, we sought to investigate the potential protective effects and
Amin Haghani et al.
eLife, 9 (2020-06-25)
The neurotoxicity of air pollution is undefined for sex and APOE alleles. These major risk factors of Alzheimer's disease (AD) were examined in mice given chronic exposure to nPM, a nano-sized subfraction of urban air pollution. In the cerebral cortex
Papavee Samatiwat et al.
Naunyn-Schmiedeberg's archives of pharmacology, 388(6), 601-612 (2015-02-25)
Resistance to chemotherapy is the major problem in cancer treatment. Cholangiocarcinoma (CCA) is the tumor arising from the bile duct epithelium. The disease is characterized by very poor prognosis and rarely responds to current radiotherapy or chemotherapy. Transcription factor Nrf2
Baixin Shen et al.
Urology, 84(4), 850-856 (2014-08-12)
To investigate the role and therapeutic potential of Nuclear factor erythroid-related factor 2 (Nrf2) in oxidative stress induced by di-N-butylphthalate (DBP) in testicular Leydig cells. Levels of reactive oxygen species (ROS) and Nrf2 in testicles from offspring of mice fed

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica