Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU072881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse 1190002h23rik

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCGCCACTTCCACTATGAGGAGCACCTAGAGCGCATGAAGCGGCGCAGCAGCGCCAGCATCAGCAACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGACTCAGTGTACAGGGACAGCTTCACCTTCAGTGATGAGAAGCTGAATTCTCCAACCAACTCCTCTCCAGCTCTCCTGCCCTCCGCTGTCACTCCTCGGAAAGCCAAATTAGGTGACACTAAAGAGCTCGAAGACTTCATTGCCGATCTGGACAGGACCTTAGCAAGTATGTGAAGCAAGGAGTTTGGGGTCCAGAAGGCTCCGAGGACCTGGCAAATCGGCTACTAGAATCTGCTGTGGAAGAGAGCAGAGCTAAGACTCCTGCCCCCTGACCATTCTTAGTTCACTATAACATTAGCCATTGGGCCCATCTCTGGGCAGTTCGGAGAGTGAAGCT

Ensembl | Número de adesão de camundongo

ENSMUSG00000022018

nº de adesão NCBI

NM_025427

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... 1190002H23Rik(66214)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

ACTRIMS-ECTRIMS MSBoston 2014: Poster Sessions 2.
Multiple sclerosis (Houndmills, Basingstoke, England), 20(1 Suppl), 285-496 (2014-09-11)
Ran Xu et al.
Molecular and cellular biochemistry, 394(1-2), 109-118 (2014-05-17)
Response gene to complement 32 (RGC32) is a novel protein originally identified as a cell cycle activator and has been demonstrated to be overexpressed in a variety of human malignancies, including lung cancer. However, the potential role of RGC32 in
Peng Zhao et al.
Cellular & molecular immunology, 12(6), 692-699 (2014-11-25)
Response gene to complement 32 (RGC-32) is a cell cycle regulator involved in the proliferation, differentiation and migration of cells and has also been implicated in angiogenesis. Here we show that RGC-32 expression in macrophages is induced by IL-4 and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica