Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU062931

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vegfa

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACCATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATT

Ensembl | Número de adesão de camundongo

ENSMUSG00000023951

nº de adesão NCBI

NM_001025257

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... VEGFA(22339) , Vegfa(22339)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
VIU
KXR
AOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xue-jun Shao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(5), 2051-2062 (2015-07-24)
Down-expression of microRNA-497 (miR-497) was often found in malignancies. The purposes of this study were to determine the expression of miR-497 in human osteosarcoma and to establish the association between miR-497 expression with cell survival and the sensitivity to cisplatin
Yang Ding et al.
Biomaterials, 35(25), 7214-7227 (2014-05-31)
We described here the mechanisms by which small interfering RNA (siRNA) molecules incorporated in reconstituted high density lipoprotein (rHDL) were efficiently transferred into the cytoplasm of cells to perform target-specific therapy of tumor angiogenesis. Using fluorescent-tagged apolipoprotein A-I (apoA-I) and
Zhili Wen et al.
PloS one, 9(9), e104666-e104666 (2014-09-25)
MicroRNAs have been appreciated in various cellular functions, including the regulation of angiogenesis. Mesenchymal-stem-cells (MSCs) transplanted to the MI heart improve cardiac function through paracrine-mediated angiogenesis. However, whether microRNAs regulate MSC induced angiogenesis remains to be clarified. Using microRNA microarray
Tingting Li et al.
International journal of nanomedicine, 10, 4279-4291 (2015-07-15)
Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI)-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (sh)RNA
Yinan Wang et al.
PloS one, 10(6), e0130341-e0130341 (2015-06-16)
The transcription factor Krüppel-like factor 4 (KLF4) has been implicated in regulating cell proliferation, migration and differentiation in a variety of human cells and is one of four factors required for the induction of pluripotent stem cell reprogramming. However, its
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica