Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU055321

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prom1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCGCAGGATGGATTCAGAGGATGTATACGACGATGTTGAGACTGTGCCCATGAAAAATTTGGAAATCGATAGTAATGGTTATCATAAAGATCATTTATATGGTGTTCACAATCCTGTTATGACAAGCCCGTCTCGATACTGACAACTGGAGTTGAAGCTGCTTGAACAACAAGATAGTCAACATGGAAAGCATCACAGATTTTGGATAGTTTCTGAGTCTTCTAGAACGTTCCAAGTGCAGAAGAAACCTGGTGGAGACTCAGGCGGGCACTAGGAACATGGCATCAGTGGTCTTAGGGATGCACTTTGTCAGGAATGAACAGTCATCATGGTTATAAGCCACATATCCATTGCAACTCATGAATGATTCTCTCCTGTTTTGTTTTTAACTTTTCTTTTTACACTGATTTTCTATTTAGACACTAAAACATATAGGGGTGCTTATTCCCCCTGGATACATTTACCTGTGAACCAGCTATTCCGGT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Karl Holmberg Olausson et al.
PloS one, 9(9), e106694-e106694 (2014-09-04)
Prominin-1 (CD133) is a commonly used cancer stem cell marker in central nervous system (CNS) tumors including glioblastoma (GBM). Expression of Prom1 in cancer is thought to parallel expression and function in normal stem cells. Using RNA in situ hybridization
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica