Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU049451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cltc

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCAGAGCTGGTGTTTCTGTATGACAAGTACGAAGAGTATGACAATGCCATCATTACCATGATGAATCACCCCACCGATGCATGGAAGGAAGGGCAGTTCAAAGACATCATCACCAAGGTGGCTAATGTGGAACTGTACTACAAAGCAATCCAGTTCTACTTAGAATTCAAGCCTTTGTTGTTAAATGACTTGCTCATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTAAAACAGCTACCACTGGTGAAACCATATTTACGCTCAGTGCAGAACCACAACAACAAATCTGTGAATGAATCACTGAACAACCTCTTTATTACTGAAGAAGATTACCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAACATCTCACTTGCTCAGCGTTTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000047126

nº de adesão NCBI

NM_001003908

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CLTC(67300) , Cltc(67300)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
NSS
YHS
AOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Odette Allonby et al.
Cellular signalling, 26(12), 2645-2657 (2014-08-26)
Ligand-induced internalisation and subsequent downregulation of receptor tyrosine kinases (RTKs) serve to determine biological outputs of their signalling. Intrinsically kinase-deficient RTKs control a variety of biological responses, however, the mechanism of their downregulation is not well understood and its analysis
Cyril Basquin et al.
The EMBO journal, 34(16), 2147-2161 (2015-07-01)
Endocytosis controls many functions including nutrient uptake, cell division, migration and signal transduction. A clathrin- and caveolin-independent endocytosis pathway is used by important physiological cargos, including interleukin-2 receptors (IL-2R). However, this process lacks morphological and dynamic data. Our electron microscopy

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica