Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU040051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hsf1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTGGTCAAGCCTGAGAGAGATGACACCGAGTTCCAGCATCCTTGTTTCTTGCGTGGACAGGAACAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGCGTGTCCACCCTGAAGAGTGAGGACATAAAAATACGCCAGGACAGTGTCACCCGGCTGTTGACAGATGTGCAGCTGATGAAGGGGAAACAGGAGTGTATGGACTCCAAGCTCCTGGCCATGAAGCACGAGAACGAGGCCCTGTGGCGGGAGGTGGCCAGCCTTCGGCAGAAGCATGCCCAGCAGCAAAAAGTTGTCAACAAGCTCATTCAGTTCCTGATCTCACTGGTGCAGTCGAACCGGATCCTGGGGGTGAAGAGAAAGATCCCTCTGATGTTGAGTGACAGCAACTCAGCACACTCTGTGCCCAAGTATGGTCGACAGTACTCCCTGGAGCATGTCCATGGTCCTGGCCCATACTCAGCTCCATCTCCAGCCTACAGCAGCTCTAGCCTTTACTCCTCTGATGCTGTCACCA

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Bin Wang et al.
Breast cancer research and treatment, 153(1), 57-66 (2015-08-01)
Heat shock factor 1 (HSF1) has long been recognized as the master transcription factor that regulates heat shock proteins (HSPs).  More recently HSF1 has been associated with a broader role in regulating response to a variety of cellular stresses beyond
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica