Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU033531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gabpa

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAGTGTTCTTTGGATGCTCATGAAATTTGCCTGCAAGATATTCAGCTGGATCCAGACCGAAGCTTGTTTGATCAAGGAGTGAAAACAGATGGGACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATGGAGCCAAAGTTGAACATTCTTGAAATTGTTAAGACTGCGGAAACGGTCGAGGTGGTCATCGATCCAGATGCCCACCACGCGGAAGCAGAAGCGCATCTCGTTGAAGAAGCTCAAGTGATAACTCTTGACGGCACCAAGCACATTACGACCATTTCAGACGAGACCTCGGAGCAGGTGACGAGATGGGCTGCTGCACTGGAAGGCTACAGAAAAGAGCAGGAGCGCCTTGGCATCCCCTATGATCCTATACACTGGTCCACGGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAGTTCAGCATGACTGATATAGACCTCACCACACTCAACATTTCGG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bo-hyun Choi et al.
PloS one, 9(9), e107158-e107158 (2014-09-17)
Photodynamic therapy (PDT) has emerged as an effective treatment for various solid tumors. The transcription factor NRF2 is known to protect against oxidative and electrophilic stress; however, its constitutive activity in cancer confers resistance to anti-cancer drugs. In the present
Laura Gambari et al.
Pharmacological research, 87, 99-112 (2014-07-08)
Hydrogen sulfide (H2S), which recently emerged as a potent regulator of tissues and organs, is broadly produced in mammalian cells but whether it can regulate bone cell function is still elusive. The main objective of this study was to establish
Hitoshi Murata et al.
PloS one, 10(11), e0142438-e0142438 (2015-11-12)
Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson's disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica