Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU018341

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGCTTAGTCTTCCTCATCGCTGTGGTCGTCATTGCCATCGTATGTAACAGACGGGGGTTTGAGCGTGCCGACTCAGAGTACACGGACAAGCTACAACACTACACCAGCGGACACATGACCCCAGGCATGAAGATCTATATAGACCCTTTCACCTATGAAGATCCTAATGAGGCAGTGCGGGAGTTTGCCAAGGAAATTGACATCTCCTGTGTCAAGATTGAGCAGGTGATCGGAGCAGGGGAATTTGGTGAGGTCTGCAGTGGCCATTTGAAGCTGCCAGGCAAGAGAGAGATCTTTGTAGCCATCAAGACCCTCAAGTCAGGATACACGGAGAAACAGCGCCGGGACTTCCTGAGTGAGGCATCCATCATGGGCCAGTTCGACCACCCCAATGTCATCCATCTGGAAGGGGTTGTCACCAAGAGCACACCTGTC

Ensembl | Número de adesão de camundongo

ENSMUSG00000028664

nº de adesão NCBI

NM_010142

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... EPHB2(13844) , Ephb2(13844)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Walaiporn Khansaard et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(10), 10031-10041 (2014-07-12)
The activation of Ephrin (Eph) receptors, the largest tyrosine kinase families of cell surface receptor, has recently been addressed in human cholangiocarcinoma (CCA). Therefore, the present study aimed to investigate the role of Eph receptors and its ligands in CCA.
Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Young Hyun Jung et al.
Biochimica et biophysica acta, 1853(8), 1905-1917 (2015-05-13)
The role of unsaturated fatty acids (UFAs) is essential for determining stem cell functions. Eph/Ephrin interactions are important for regulation of stem cell fate and localization within their niche, which is significant for a wide range of stem cell behavior.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica