Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU010191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gper

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTACCTAGGTCCCGTGTGGCCAGCCCCTTCCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGGGGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTTCCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCCCAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTTCAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAACATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTT

Ensembl | Número de adesão de camundongo

ENSMUSG00000053647

nº de adesão NCBI

NM_029771

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... GPER(76854) , Gper(76854)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
CDT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wenqing Cao et al.
PloS one, 7(12), e52838-e52838 (2013-01-04)
Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA) on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6), eicosapentaenoic acid (EPA
Rainer Girgert et al.
Breast cancer research and treatment, 134(1), 199-205 (2012-02-01)
Triple-negative breast cancers lack estrogen receptor α (ERα), progesterone receptor, and do not overexpress human epidermal growth factor receptor 2 (Her-2). They are neither susceptible to endocrine therapy nor to a therapy using the anti-Her-2 antibody, trastuzumab. Therefore, an efficient
Whitney K Petrie et al.
Obstetrics and gynecology international, 2013, 472720-472720 (2014-01-01)
Endometrial carcinoma is the most common cancer of the female reproductive tract. GPER/GPR30 is a 7-transmembrane spanning G protein-coupled receptor that has been identified as the third estrogen receptor, in addition to ERα and ERβ. High GPER expression is predictive
Nicolas Chevalier et al.
PloS one, 7(4), e34672-e34672 (2012-04-13)
Testicular germ cell tumours are the most frequent cancer of young men with an increasing incidence all over the world. Pathogenesis and reasons of this increase remain unknown but epidemiological and clinical data have suggested that fetal exposure to environmental
Q K Y Chan et al.
Cell death and differentiation, 17(9), 1511-1523 (2010-03-06)
G-protein-coupled receptor-30 (GPR30) shows estrogen-binding affinity and mediates non-genomic signaling of estrogen to regulate cell growth. We here showed for the first time, in contrast to the reported promoting action of GPR30 on the growth of breast and ovarian cancer
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica