Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU223451

Sigma-Aldrich

MISSION® esiRNA

targeting human POU5F1 (2)

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

50 μG
R$ 1.765,00
20 μG
R$ 1.765,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
50 μG
R$ 1.765,00
20 μG
R$ 1.765,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAG

Ensembl | Número de adesão de ser humano

ENSG00000206454

nº de adesão NCBI

NM_203289

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... POU5F1(5460) , POU5F1(5460)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
OAV
JQU
TOU
COU
JDU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shaoheng Zhang et al.
Cell death & disease, 8(1), e2548-e2548 (2017-01-13)
Poor cell survival and limited functional benefits have restricted mesenchymal stem cell (MSC) efficacy for treating myocardial infarction (MI), suggesting that a better understanding of stem cell biology is needed. The transcription factor HIF-2α is an essential regulator of the
Axel R Göhring et al.
PloS one, 12(4), e0174912-e0174912 (2017-04-21)
Oct4 was reported to be one of the most important pluripotency transcription factors in the biology of stem cells including cancer stem cells, and progressed malignant cells. Here we report the investigation of gene expression control of Oct4 by selected
Lei Liu et al.
Biochemical and biophysical research communications, 461(3), 525-532 (2015-04-26)
Our previous study showed that Octamer-binding transcription factor 4 (OCT4) expression was upregulated and significantly associated with histological grade through the analysis of OCT4 expression in 159 ovarian cancer tissue samples, and OCT4 mediated follicle-stimulating hormone (FSH)-induced anti-apoptosis in epithelial
Sung-Jen Wei et al.
Cell death & disease, 11(5), 368-368 (2020-05-16)
Despite the improvement in clinical outcome with 13-cis-retinoic acid (13-cisRA) + anti-GD2 antibody + cytokine immunotherapy given in first response ~40% of high-risk neuroblastoma patients die of recurrent disease. MYCN genomic amplification is a biomarker of aggressive tumors in the
Pengmu Xie et al.
Experimental and molecular pathology, 108, 9-16 (2019-03-12)
Endometrial cancer (EC) is ranked as the most common gynecologic malignancy of the female genital tract and the fourth most common neoplasia in women. Accumulated evidences reveal that TRAF4 plays a critical role in the progress of various cancers, but
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica