Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU159061

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAA

Ensembl | Número de adesão de ser humano

ENSG00000050628

nº de adesão NCBI

NM_198716

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTGER3(5733) , PTGER3(5733)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cristian Rodriguez-Aguayo et al.
EBioMedicine, 40, 290-304 (2019-01-19)
Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. An association between higher tumoral expression of PTGER3 and shorter
Yao Ye et al.
Journal of cancer research and clinical oncology, 146(9), 2189-2203 (2020-06-04)
Cervical cancer metastasis results in poor prognosis and increased mortality, which is not separated from inflammatory reactions accumulated by prostaglandin E2 (PGE2). As a specific G-protein coupled PGE2 receptor, EP3 is demonstrated as a negative prognosticator of cervical malignancy. Now
Ju-Fang Liu et al.
Molecular cancer, 9, 43-43 (2010-02-25)
Cyclooxygenase (COX)-2, the inducible isoform of prostaglandin (PG) synthase, has been implicated in tumor metastasis. Interaction of COX-2 with its specific EP receptors on the surface of cancer cells has been reported to induce cancer invasion. However, the effects of
Chenggang Li et al.
Molecular cancer research : MCR, 15(10), 1318-1330 (2017-07-16)
Tuberous sclerosis complex (TSC) is a tumor-suppressor syndrome affecting multiple organs, including the brain, skin, kidneys, heart, and lungs. TSC is associated with mutations in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica