Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU156861

Sigma-Aldrich

MISSION® esiRNA

targeting human IKZF1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAAAGCCCTCCCGCGCCCCCACCCCAGACCCCGAGCCACCCCAGGAAAAGCACAAGGACTGCCGCCTTCTCGCTCCCGCCAGCAGCATAGACTGGACTGGACCAGACAATGTTGTGTTTGGATTTGTAACTGTTTTTTGTTTTTTGTTTGAGTTGGTTGATTGGGGTTTGATTTGCTTTTGAAAAGATTTTTATTTTTAGAGGCAGGGCTGCATTGGGAGCATCCAGAACTGCTACCTTCCTAGATGTTTCCCCAGACCGCTGGCTGAGATTCCCTCACCTGTCGCTTCCTAG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Maud Lemarié et al.
PLoS genetics, 17(3), e1009478-e1009478 (2021-03-27)
The tumor suppressor IKAROS binds and represses multiple NOTCH target genes. For their induction upon NOTCH signaling, IKAROS is removed and replaced by NOTCH Intracellular Domain (NICD)-associated proteins. However, IKAROS remains associated to other NOTCH activated genes upon signaling and
Ipsita Guha et al.
Frontiers in immunology, 11, 898-898 (2020-06-26)
Tumor progression in the host leads to severe impairment of intrathymic T-cell differentiation/maturation, leading to the paralysis of cellular anti-tumor immunity. Such suppression manifests the erosion of CD4+CD8+ double-positive (DP) immature thymocytes and a gradual increase in CD4-CD8- double negative
Nicholas A Vitanza et al.
Pediatric blood & cancer, 61(10), 1779-1785 (2014-07-01)
Ikaros, the product of IKZF1, is a regulator of lymphoid development and polymorphisms in the gene have been associated with the acute lymphoblastic leukemia (ALL). Additionally, IKZF1 deletions and mutations identify high-risk biological subsets of childhood ALL [Georgopoulos et al.

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica