Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU154611

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNA3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACATCATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGACAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCATCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGAGCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAGGCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAACAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGCCGGTGTCTTGACCATCGCATTG

Ensembl | Número de adesão de ser humano

ENSG00000177272

nº de adesão NCBI

NM_002232

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KCNA3(3738) , KCNA3(3738)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiao-Hong Kan et al.
Archives of biochemistry and biophysics, 591, 150-156 (2016-01-10)
Ion channels expressed in macrophages have been tightly related to atherosclerosis by coupling cellular function. How the voltage-gated potassium channels (Kv) affect macrophage migration remain unknown. The aim of our study is to investigate whether Kv1.3-ERK signaling pathway plays an
Marat Khodoun et al.
Science advances, 6(47) (2020-11-20)
Lupus nephritis (LN) is an autoimmune disease with substantial morbidity/mortality and limited efficacy of available therapies. Memory T (Tm) lymphocytes infiltrate LN kidneys, contributing to organ damage. Analysis of LN, diabetic nephropathy, and healthy donor kidney biopsies revealed high infiltration
Roberta Peruzzo et al.
Redox biology, 37, 101705-101705 (2020-10-03)
The potassium channel Kv1.3, involved in several important pathologies, is the target of a family of psoralen-based drugs whose mechanism of action is not fully understood. Here we provide evidence for a physical interaction of the mitochondria-located Kv1.3 (mtKv1.3) and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica