Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU154411

Sigma-Aldrich

MISSION® esiRNA

targeting human AHCY

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGCAAGCTGAATGTGAAGTTGACCAAGCTAACTGAGAAGCAAGCCCAGTACCTGGGCATGTCCTGTGATGGCCCCTTCAAGCCGGATCACTACCGCTACTGAGAGCCAGGTCTGCGTTTCACCCTCCAGCTGCTGTCCTTGCCCAGGCCCCACCTCTCCTCCCTAAGAGCTAATGGCACCAACTTTGTGATTGGTTTGTCAGTGTCCCCCATCGACTCTCTGGGGCTGATCACTTAGTTTTTGGCCTCTGCTGCAGCCGTCATACTGTTCCAAATGTGGCAGCGGGAACAGAGTACCCTCTTCAAGCCCCGGTCATGATGGAGGTCCCAGCCACAGGGAACCATGAGCTCAGTGGTCTTGGAACAGCTCACTAAGTCAGTCCTTCCTTAGCCTGGAAGTCAGTAGTGGAGTCACAAAGCCCATGTGTTTTGCCATCTAGGCCTTCACCTGGTCTGTGGACTTATACCTGTGTGCTTGGTTTACAGGTCCAGTGGTTCTTCAGCCCATGACAGATGAG

Ensembl | Número de adesão de ser humano

ENSG00000101444

nº de adesão NCBI

NM_000687

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AHCY(191) , AHCY(191)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

V K Chaithanya Ponnaluri et al.
Journal of molecular biology, 430(14), 2051-2065 (2018-05-15)
DNA (cytosine-5) methyltransferase 1 (DNMT1) is essential for mammalian development and maintenance of DNA methylation following DNA replication in cells. The DNA methylation process generates S-adenosyl-l-homocysteine, a strong inhibitor of DNMT1. Here we report that S-adenosylhomocysteine hydrolase (SAHH/AHCY), the only
Carolina Magdalen Greco et al.
Science advances, 6(51) (2020-12-18)
Circadian gene expression driven by transcription activators CLOCK and BMAL1 is intimately associated with dynamic chromatin remodeling. However, how cellular metabolism directs circadian chromatin remodeling is virtually unexplored. We report that the S-adenosylhomocysteine (SAH) hydrolyzing enzyme adenosylhomocysteinase (AHCY) cyclically associates
Sae Jeong Park et al.
American journal of cancer research, 5(7), 2127-2138 (2015-09-04)
S-adenosylhomocysteine hydrolase (AHCY) hydrolyzes S-adenosylhomocysteine to adenosine and l-homocysteine, and it is already known that inhibition of AHCY decreased cell proliferation by G2/M arrest in MCF7 cells. However, the previous study has not indicated what mechanism the cell cycle arrest

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica