Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU153581

Sigma-Aldrich

MISSION® esiRNA

targeting human TESC

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTACCATTCGCAAGGAGAACTTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAACAGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTAAAGTGGTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ai-Jing Luo et al.
Experimental and molecular pathology, 107, 110-117 (2018-12-31)
Renal cell carcinoma (RCC) is the most common form of kidney cancer. Recent studies reported that Tescalcin was overexpressed in various tumor types. However, the status of Tescalcin protein expression in RCC and its biological function is uncertain. This study
Jieun Kang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13843-13853 (2016-08-04)
We reported previously that tescalcin (TESC) levels were higher in tissue and serum from colorectal cancer (CRC) patients and suggested that TESC was a potential oncotarget in CRC. The aim of this study was to investigate the function of TESC
Yun Hee Kang et al.
Oncotarget, 5(8), 2149-2160 (2014-05-09)
Tescalcin (TESC) is an EF-hand calcium binding protein that is differentially expressed in several tissues, however it is not reported that the expression and functional roles of TESC in colorectal cancer. Levels of messenger RNA (mRNA) and protein expression of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica