Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU150811

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1A

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
Preço e disponibilidade não estão disponíveis no momento.

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGTCCTTGGTAGAGGGCTACTTTACTGTAACAGGGCCAGGGTGGAGAGTTCTCTCCTGAAGCTCCATCCCCTCTATAGGAAATGTGTTGACAATATTCAGAAGAGTAAGAGGATCAAGACTTCTTTGTGCTCAAATACCACTGTTCTCTTCTCTACCCTGCCCTAACCAGGAGCTTGTCACCCCAAACTCTGAGGTGATTTATGCCTTAATCAAGCAAACTTCCCTCTTCAGAAAAGATGGCTCATTTTCCCTCAAAAGTTGCCAGGAGCTGCCAAGTATTCTGCCAATTCACCCTGGAGCACAATCAACAAATTCAGCCAGAACACAACTACAGCTACTATTAGAACTATTATTATTAATAAATTCCTCTCCAAATCTAGCCCCTTGACTTCGGATTTCACG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IL1A(3552)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xin Jiang et al.
Scientific reports, 7(1), 5270-5270 (2017-07-15)
Diabetes is an inflammatory disease. Inflammation plays an important role in islet functions. However, the exact mechanisms by which inflammation affects islet functions remain unclear. In this study, we investigated the regulatory effects of miR-30a on inflammation and islet functions.
Chuyue Zhang et al.
Immunology and cell biology, 95(10), 943-952 (2017-09-08)
Preterm premature rupture of membranes (pPROMs) account for one-third of preterm births, a leading cause of neonatal death. Understanding the mechanism of membrane rupture is thus of clinical significance in the prevention of preterm birth. Parturition at both term and

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica