Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU150021

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAD

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGATGGA

Ensembl | Número de adesão de ser humano

ENSG00000148218

nº de adesão NCBI

NM_000031

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ALAD(210) , ALAD(210)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
SOT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhou Zheng et al.
Fish & shellfish immunology, 81, 168-175 (2018-07-17)
Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus vannamei and constitute part of the coagulation system, the
Guicai Gao et al.
Developmental and comparative immunology, 98, 99-107 (2019-05-06)
White spot syndrome, which is caused by white spot syndrome virus (WSSV), is a highly contagious disease of penaeid shrimp. However, there is currently incomplete understanding of the infection mechanism and pathogenesis of WSSV. In this study, a novel gene
Gang Liu et al.
Nature communications, 11(1), 6310-6310 (2020-12-11)
Heme biosynthesis and iron-sulfur cluster (ISC) biogenesis are two major mammalian metabolic pathways that require iron. It has long been known that these two pathways interconnect, but the previously described interactions do not fully explain why heme biosynthesis depends on

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica