Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU147971

Sigma-Aldrich

MISSION® esiRNA

targeting human MIF

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTGGTGTCCGAGAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGGGCTGGAACAACTC

Ensembl | Número de adesão de ser humano

ENSG00000099964

nº de adesão NCBI

NM_002415

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MIF(4282) , MIF(4282)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
VFT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yu Zhang et al.
Clinical and experimental pharmacology & physiology, 43(11), 1134-1144 (2016-10-21)
Macrophage migration inhibitory factor (MIF), a pleiotropic pro-inflammatory cytokine, is a key regulator in both innate and acquired immunity systems. MIF has become a promising drug target for inflammatory diseases. Apart from its cytokine activities, MIF is known to act
Mei Zhang et al.
Molecular carcinogenesis, 58(6), 898-912 (2019-01-23)
Macrophage migration inhibitory factor (MIF) is a prominent orchestrator during the onset and progression of cancer. Recently, MIF was detected in salivary adenoid cystic carcinoma (SACC). However, its functional effect in perineural invasion (PNI) of SACC remained unknown. To illuminate
Milica Jovanović Krivokuća et al.
Reproduction, fertility, and development (2020-12-17)
Extravillous trophoblasts are specific placental cells that invade the uterine stroma and spiral arteries modifying and adjusting them to pregnancy. Many pregnancy pathologies are associated with impairment of this process, including preeclampsia and intrauterine growth restriction, among others. Macrophage migration
Yong-Chao Jiang et al.
Journal of biomedical materials research. Part A, 106(6), 1595-1603 (2018-02-11)
During the process of tissue regeneration facilitated by stem cells, physical properties of a scaffold affect behavior and activities of the cell. To enhance differentiation of human mesenchymal stem cells (MSCs) into endothelial-like cells (ELCs), we used electrospun fibrous substrates
Mi Jeong Kim et al.
Cellular signalling, 34, 110-120 (2017-03-23)
The nuclear factor kappa B (NF-κB) pathway is pivotal in controlling survival and apoptosis of cancer cells. Macrophage migration inhibitory factor (MIF), a cytokine that regulates the immune response and tumorigenesis under inflammatory conditions, is upregulated in various tumors. However
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica