Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU145431

Sigma-Aldrich

MISSION® esiRNA

targeting human AICDA

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em02 de junho de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em02 de junho de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTGCTCTTCCTCCGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGGTTCACCTCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGGAACCCCAACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAGGCTGAGCCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACCTTCAAAGATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCACGAAAGAACTTTCAAAGCCTGGGAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCGGCGCATCCTTTTGCCCCTGTATGAG

Ensembl | Número de adesão de ser humano

ENSG00000111732

nº de adesão NCBI

NM_020661

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AICDA(57379) , AICDA(57379)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
UKT
NGT
RRS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xudong Ao et al.
Cytotechnology, 68(6), 2637-2648 (2016-08-11)
DNA methylation in mammals is an epigenetic marker and necessary for normal embryogenesis. The global genomic demethylation of 5-methylcytosine occurs during the first cell cycle following fertilization. Activation-induced cytidine deaminase (AID), which is well-known for the function in antibody diversification
Grant Godsmark et al.
Anticancer research, 41(1), 237-247 (2021-01-10)
Activation-induced cytidine deaminase (AID) is a DNA modifying enzyme which has an essential function in promoting antibody diversification. Its overexpression is strongly associated with B-cell derived malignancies including Burkitt lymphoma, where AID is required for the characteristic c-MYC/IGH translocation. This
Yugo Sawai et al.
Cancer research, 75(16), 3292-3301 (2015-06-27)
Pancreatic ductal adenocarcinoma (PDAC) develops via an accumulation of various gene mutations. The mechanism underlying the mutations in PDAC development, however, is not fully understood. Recent insight into the close association between the mutation pattern of various cancers and specific

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica