Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU144761

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD8

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em02 de maio de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em02 de maio de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTGCGGGTACGAATGCTATACTACCTGAGGCAGGAGGTTATTGGAGACCAAGCAGAAAAGGTGTTAGGGGGTGCGATTGCCAGTGAGATTGACATATGGTTCCCAGTAGTGGATCAACTGGAGGTTCCAACAACTTGGTGGGACAGTGAGGCTGACAAGTCGCTGCTCATTGGAGTCTTTAAACATGGCTATGAGAAATATAATACCATGAGGGCAGACCCAGCCTTATGTTTCCTAGAAAAGGCTGGCCGACCAGATGACAAAGCAATTGCAGCAGAACATCGAGTGTTGGATAACTTCTCTGACATAGTAGAAGGGGTTGACTTTGATAAAGATTGTGAAGATCCTGAATATAAACCACTCCAAGGTCCCCCAAAGGACCAAGATGATGAGGGTGATCCCTTGATGATGATGGATGAGGAGATCTCAGTGATTGATGGAGATGAAGCCCAGGTGACCCAACAGCCAGGCCATTTATT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Justin Cotney et al.
Nature communications, 6, 6404-6404 (2015-03-11)
Recent studies implicate chromatin modifiers in autism spectrum disorder (ASD) through the identification of recurrent de novo loss of function mutations in affected individuals. ASD risk genes are co-expressed in human midfetal cortex, suggesting that ASD risk genes converge in
Chuntao Zhao et al.
Developmental cell, 45(6), 753-768 (2018-06-20)
Disruptive mutations in chromatin remodeler CHD8 cause autism spectrum disorders, exhibiting widespread white matter abnormalities; however, the underlying mechanisms remain elusive. We show that cell-type specific Chd8 deletion in oligodendrocyte progenitors, but not in neurons, results in myelination defects, revealing
María Ceballos-Chávez et al.
PLoS genetics, 11(4), e1005174-e1005174 (2015-04-22)
While the importance of gene enhancers in transcriptional regulation is well established, the mechanisms and the protein factors that determine enhancers activity have only recently begun to be unravelled. Recent studies have shown that progesterone receptor (PR) binds regions that

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica