Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU144451

Sigma-Aldrich

MISSION® esiRNA

targeting human NUPR1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCCCACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGGATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGAGGTGGAGGCCGGAAAGGTCGCACCAAGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGGTGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTGGAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGGAGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCCGCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAGATGGGGAGTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ki-Sun Kim et al.
Anatomy & cell biology, 45(1), 17-25 (2012-04-27)
Nuclear protein-1 (NUPR1) is a small nuclear protein that is responsive to various stress stimuli. Although NUPR1 has been associated with cancer development, its expression and roles in cholangiocarcinoma have not yet been described. In the present study, we found
Patricia M Schnepp et al.
Molecular cancer research : MCR, 18(9), 1290-1301 (2020-06-10)
The majority of patients with prostate cancer treated with docetaxel develop resistance to it. To better understand the mechanism behind the acquisition of resistance, we conducted single-cell RNA-sequencing (scRNA-seq) of docetaxel-sensitive and -resistant variants of DU145 and PC3 prostate cancer
Anthony Murphy et al.
Oncology reports, 45(4) (2021-03-03)
Nickel (Ni) is carcinogenic to humans, and causes cancers of the lung, nasal cavity, and paranasal sinuses. The primary mechanisms of Ni‑mediated carcinogenesis involve the epigenetic reprogramming of cells and the ability for Ni to mimic hypoxia. However, the exact
Yanchao Mu et al.
Autophagy, 14(4), 654-670 (2017-11-14)
In the advanced stages of cancer, autophagy is thought to promote tumor progression through its ability to mitigate various cellular stresses. However, the details of how autophagy is homeostatically regulated in such tumors are unknown. Here, we report that NUPR1

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica