Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU143331

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXO22

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACCATTGGCTTCATGTTTGCATGCGTTGGCAGGGGCTTTCAGTATTACAGAGCCAAGGGGAATGTTGAGGCTGATGCATTTAGAAAGTTTTTTCCTAGTGTTCCCTTATTCGGCTTCTTTGGAAATGGAGAAATTGGATGTGATCGGATAGTCACTGGGAACTTTATATTGAGGAAATGTAATGAGGTAAAAGATGATGATCTGTTTCATAGCTATACAACAATAATGGCACTCATACATCTGGGGTCATCTAAATAATAATTAAAGTGGCTTTCATAATATGTAACTTTTGGGTTCTGCCTTTTTCAGAAAATGGAAACTTGGGCCATGTGTATTTCAAACAAAAATAACTTTAGATATATCTTTTTTGTAGCTTTGATTGATGCTCTAAGATCACATGAGGGTAGTATTTAATATATTAGATGAAGGACAACTTTGGACATAACACTGACTAGGAGTTGAGAGCTTTTGCATCAGGCAGAAGCAAACTG

Ensembl | Número de adesão de ser humano

ENSG00000167196

nº de adesão NCBI

NM_012170

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FBXO22(26263) , FBXO22(26263)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XZU
ZYU
KXU
OWU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xun-Kai Hou et al.
Biochemical and biophysical research communications, 523(3), 766-772 (2020-01-18)
Long noncoding RNA small nucleolus RNA host gene 14 (SNHG14) has been shown to exert oncogenic functions in seceral cancers, but its role in osteosarcoma still unclear. In this present study, we found that SNHG14 was significantly upregulated in osteosarcoma
Feng Guo et al.
International journal of biological sciences, 15(3), 647-656 (2019-02-13)
F-box only protein 22 (FBXO22), a substrate receptor of the SKP1-Cullin 1-F-box protein (SCF) E3 ubiquitin ligase that targets key regulators of cellular activities for ubiquitylation and degradation, plays important roles in the progression of human cancer. However, little is
Long Zhang et al.
Journal of experimental & clinical cancer research : CR, 38(1), 101-101 (2019-02-28)
Deregulation of ubiquitin ligases is related to the malignant progression of human cancers. F-box only protein 22 (FBXO22), an F-box E3 ligase, is a member of the F-box protein family. However, the biological function of FBXO22 in HCC and the

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica