Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU142651

Sigma-Aldrich

MISSION® esiRNA

targeting human RSAD2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGAGCAATGGAAGCCTGATCCGGGAGAGGTGGTTCCAGAATTATGGTGAGTATTTGGACATTCTCGCTATCTCCTGTGACAGCTTTGACGAGGAAGTCAATGTCCTTATTGGCCGTGGCCAAGGAAAGAAGAACCATGTGGAAAACCTTCAAAAGCTGAGGAGGTGGTGTAGGGATTATAGAGTCGCTTTCAAGATAAATTCTGTCATTAATCGTTTCAACGTGGAAGAGGACATGACGGAACAGATCAAAGCACTAAACCCTGTCCGCTGGAAAGTGTTCCAGTGCCTCTTAATTGAGGGTGAGAATTGTGGAGAAGATGCTCTAAGAGAAGCAGAAAGATTTGTTATTGGTGATGAAGAATTTGAAAGATTCTTGGAGCGCCACAAAGAAGTGTCCTGCTTGGTGCCTGAATCTAACCAGAAGATGAAAGACTCCTACCTTATTCTGGATGAATATATGCGCTTTCTGAACTGTAGAAAGGGACGGAAGGA

Ensembl | Número de adesão de ser humano

ENSG00000134321

nº de adesão NCBI

NM_080657

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RSAD2(91543) , RSAD2(91543)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

B Wang et al.
Placenta, 36(6), 667-673 (2015-03-31)
Viperin, a virus-inducible antiviral protein, has been reported to inhibit the replication of a variety of viruses. However, its expression and function in trophoblast cells remains unclear. Toll-like receptor 3 (TLR3) is a key component of the innate immune system
Keaton M Crosse et al.
Immunology and cell biology, 99(4), 373-391 (2020-11-02)
Viperin is an interferon-inducible protein that is pivotal for eliciting an effective immune response against an array of diverse viral pathogens. Here we describe a mechanism of viperin's broad antiviral activity by demonstrating the protein's ability to synergistically enhance the
José R Peña Cárcamo et al.
Virology, 514, 216-229 (2017-12-05)
Junín arenavirus infections are associated with high levels of interferons in both severe and fatal cases. Upon Junín virus (JUNV) infection a cell signaling cascade initiates, that ultimately attempts to limit viral replication and prevent infection progression through the expression
Ji-Su Jang et al.
Cell death & disease, 9(8), 823-823 (2018-08-03)
Dendritic cells (DCs) are the most potent professional antigen presenting cells and inducers of T cell-mediated immunity. However, few specific markers of mature DCs (mDC) have been reported. A previous microarray analysis revealed expression of mDC-specific genes and identified Rsad2

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica