Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU136281

Sigma-Aldrich

MISSION® esiRNA

targeting human NPC1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em10 de maio de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em10 de maio de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGATTGTGGTGTTGGCTTTTGCCAAATCTCAAATTTTCCAGATATTCTACTTCAGGATGTATTTGGCCATGGTCTTACTGGGAGCCACTCACGGATTAATATTTCTCCCTGTCTTACTCAGTTACATAGGGCCATCAGTAAATAAAGCCAAAAGTTGTGCCACTGAAGAGCGATACAAAGGAACAGAGCGCGAACGGCTTCTAAATTTCTAGCCCTCTCGCAGGGCATCCTGACTGAACTGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGCCAAGTTGAACACCGGATGGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCACAGTTGACTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAAAGAAACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACTCTGTAAAGGCCAATCAATGCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaoyang Xu et al.
Journal of cellular and molecular medicine, 21(2), 364-374 (2016-09-16)
Statins, 3-hydroxyl-3-methylglutaryl coenzyme A reductase inhibitors, are the first-line medications prescribed for the prevention and treatment of coronary artery diseases. The efficacy of statins has been attributed not only to their systemic cholesterol-lowering actions but also to their pleiotropic effects
Yudong Song et al.
Biomaterials, 150, 1-13 (2017-10-14)
Arginine and α-tocopherol succinate (α-TOS) double grafted N-trimethyl chitosan chloride (TMC) nanoparticles (TAS NPs) were designed and developed for effective co-delivery of doxorubicin (DOX) and Survivin shRNA-expressing pDNA (iSur-pDNA). With DOX loading into the hydrophobic core and iSur-pDNA combining to
Saskia Heybrock et al.
Nature communications, 10(1), 3521-3521 (2019-08-08)
The intracellular transport of cholesterol is subject to tight regulation. The structure of the lysosomal integral membrane protein type 2 (LIMP-2, also known as SCARB2) reveals a large cavity that traverses the molecule and resembles the cavity in SR-B1 that
Guanghong Liao et al.
Experimental neurology, 269, 67-74 (2015-04-14)
Niemann-Pick type C (NPC) disease is a genetic disorder associated with intracellular cholesterol accumulation in the brain and other organs, and neurodegeneration is generally believed to be the fatal cause of the disease. In view of the emerging role of

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica