Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU134551

Sigma-Aldrich

MISSION® esiRNA

targeting human NRP1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em10 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em10 de maio de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGTAGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAAGAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATAAAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTATTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTATGAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCTGGA

Ensembl | Número de adesão de ser humano

ENSG00000099250

nº de adesão NCBI

NM_001024628

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NRP1(8829) , NRP1(8829)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
NXT
WNS
BJS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pezhman Salehi et al.
PLoS genetics, 13(10), e1007048-e1007048 (2017-10-24)
Neuropilin-1 (Nrp1) encodes the transmembrane cellular receptor neuropilin-1, which is associated with cardiovascular and neuronal development and was within the peak SNP interval on chromosome 8 in our prior GWAS study on age-related hearing loss (ARHL) in mice. In this
Rebecca McLennan et al.
Developmental biology, 407(1), 12-25 (2015-08-19)
Embryonic neural crest cells travel in discrete streams to precise locations throughout the head and body. We previously showed that cranial neural crest cells respond chemotactically to vascular endothelial growth factor (VEGF) and that cells within the migratory front have
Toru Nakanishi et al.
Cell death & disease, 10(2), 67-67 (2019-01-27)
Following incomplete spinal cord injury (SCI), reorganization of the corticospinal tract (CST) contributes to spontaneous motor recovery. Axotomized CST fibers form collaterals and make synapses with interneurons, followed by pruning of excess fibers. Although axonal pruning is involved in refinement
Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Jiahui Cao et al.
Nature communications, 8(1), 2210-2210 (2017-12-22)
VEGFR-2/Notch signalling regulates angiogenesis in part by driving the remodelling of endothelial cell junctions and by inducing cell migration. Here, we show that VEGF-induced polarized cell elongation increases cell perimeter and decreases the relative VE-cadherin concentration at junctions, triggering polarized
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica