Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU133701

Sigma-Aldrich

MISSION® esiRNA

targeting human TYMS

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTCAAAGGAGCTCGAAGGATATTGTCAGTCTTTAGGGGTTGGGCTGGATGCCGAGGTAAAAGTTCTTTTTGCTCTAAAAGAAAAAGGAACTAGGTCAAAAATCTGTCCGTGACCTATCAGTTATTAATTTTTAAGGATGTTGCCACTGGCAAATGTAACTGTGCCAGTTCTTTCCATAATAAAAGGCTTTGAGTTAACTCACTGAGGGTATCTGACAATGCTGAGGTTATGAACAAAGTGAGGAGAATGAAATGTATGTGCTCTTAGCAAAAACATGTATGTGCATTTCAATCCCACGTACTTATAAAGAAGGTTGGTGAATTTCACAAGCTATTTTTGGAATATTTTTAGAATATTTTAAGAATTTCACAAGCTATTCCCTCAAATCTGAGGGAGCTGAGTAACACCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Motoki Watanabe et al.
Cancers, 13(5) (2021-03-04)
Natural products have numerous bioactivities and are expected to be a resource for potent drugs. However, their direct targets in cells often remain unclear. We found that rabdosianone I, which is a bitter diterpene from an oriental herb for longevity
Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica