Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130951

Sigma-Aldrich

MISSION® esiRNA

targeting human OVOL1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTCCCAGTGGAGACCTGTTCACCTGCCGTGTCTGCCAGAAGGCCTTCACCTACCAGCGCATGCTGAACCGCCACATGAAGTGTCACAACGACGTCAAGAGGCACCTCTGCACGTACTGCGGGAAGGGCTTCAATGACACCTTCGACCTCAAGAGACACGTCCGAACTCACACTGGCGTGCGGCCCTACAAGTGCAGCCTGTGTGACAAGGCCTTCACGCAGCGCTGCTCTCTGGAGTCTCACCTCAAGAAGATCCATGGTGTGCAGCAGAAGTACGCGTACAAGGAGCGGCGGGCCAAGCTGTACGTGTGTGAGGAGTGCGGCTGCACATCTGAGAGCCAGGAGGGCCACGTCCTGCACCTGAAGGAGCACCACCCTGACAGCCCGCTGCTGCGCAAGACCTCCAAGAAGGTG

Ensembl | Número de adesão de ser humano

ENSG00000172818

nº de adesão NCBI

NM_004561

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... OVOL1(5017) , OVOL1(5017)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PYR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Akiko Hashimoto-Hachiya et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Rhodiola species are antioxidative, salubrious plants that are known to inhibit oxidative stress induced by ultraviolet and γ-radiation in epidermal keratinocytes. As certain phytochemicals activate aryl hydrocarbon receptors (AHR) or OVO-like 1 (OVOL1) to upregulate the expression of epidermal barrier
Maho Murata et al.
Journal of clinical medicine, 9(3) (2020-02-29)
Progression of actinic keratosis (AK) to cutaneous squamous cell carcinoma (cSCC) is rare. Most cases of AK remain as intraepidermal lesions, owing to the suppression of the epithelial-to-mesenchymal transition (EMT). Ovo-like transcriptional repressor 1 (OVOL1) and ovo-like zinc finger 2
Stephen J Renaud et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(45), E6175-E6184 (2015-10-28)
Epithelial barrier integrity is dependent on progenitor cells that either divide to replenish themselves or differentiate into a specialized epithelium. This paradigm exists in human placenta, where cytotrophoblast cells either propagate or undergo a unique differentiation program: fusion into an

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica