Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU127401

Sigma-Aldrich

MISSION® esiRNA

targeting human BRAF

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGA

Ensembl | Número de adesão de ser humano

ENSG00000157764

nº de adesão NCBI

NM_004333

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BRAF(673) , BRAF(673)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yujuan Zhang et al.
Nanomedicine : nanotechnology, biology, and medicine, 14(5), 1679-1693 (2018-04-24)
Melanoma is significantly associated with mutant BRAF gene, a suitable target for siRNA-based anti-melanoma therapy. However, a tumor-specific delivery system is a major hurdle for clinical applications. Here, we developed a novel nano-carrier, FA-GNR-siBRAF for safe topical application, which consists
Lin Feng et al.
Biochemical and biophysical research communications, 524(1), 28-35 (2020-01-26)
BRAFV600E mutation is frequently observed in melanoma, and contributes to tumor malignancy. Despite inhibition of BRAF causes a profound cell growth inhibition and a strong clinical benefit in BRAFV600E melanoma, acquired drug resistance is still the major hurdle. In this
Hitoshi Sase et al.
Molecular cancer therapeutics, 17(10), 2217-2225 (2018-07-27)
FGFR2 gene is frequently amplified in gastric cancer. Recently, targeting FGFR2 has drawn attention as a form of gastric cancer therapy, and FGFR-selective inhibitors have shown promising efficacy in clinical studies. Because overcoming acquired resistance is a common problem with
Cindy Kundlacz et al.
Journal of virology, 93(16) (2019-06-07)
Bluetongue virus (BTV) is an arbovirus transmitted by blood-feeding midges to a wide range of wild and domestic ruminants. In this report, we showed that BTV, through its nonstructural protein NS3 (BTV-NS3), is able to activate the mitogen-activated protein kinase/extracellular
Samantha K McCarty et al.
Endocrine-related cancer, 21(6), 865-877 (2014-09-18)
Increased p21-activated kinase (PAK) signaling and expression have been identified in the invasive fronts of aggressive papillary thyroid cancers (PTCs), including those with RET/PTC, BRAFV600E, and mutant RAS expression. Functionally, thyroid cancer cell motility in vitro is dependent on group
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica