Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU124361

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5B

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em14 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em14 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTTGTTAGAGGGCCCAGAGTTCCTTCTCCACCCCCGCTCTCTCTCTCTTGGCCTGAGATCTCTGTGCAGGAACCAAGATGGGGCTGAAGCCTCTGGAGGCAGTTGGTTGGGGGCGGGCAGGCAGGAGGCCCTCCCTCCACCCCCCCACCCTCAGCCCGGCAACTTCTGGGTTCCATGGGTTTTAGTTCCGTTCTCGTTTTCTTCCTCCGTTATTGATTTCTCCTTTCTCCCTAAGCCCCCTTCTGCTTCCACGCCCTTTTCCTCTTTGAAGAGTCAAGTACAATTCAGACAAACTGCTTTCTCCTGTCCAAAAGCAAAAAGGCAAAGGAAAGAAAGAAAGCTTCAGACCGCTAGTAAGGCTCAAAGAAGAAGAAAAACACCAAAACCACAAGGGAAAAG

Ensembl | Número de adesão de ser humano

ENSG00000107731

nº de adesão NCBI

NM_170744

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UNC5B(219699) , UNC5B(219699)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
OHT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zongyi Xie et al.
Brain, behavior, and immunity, 69, 190-202 (2017-11-23)
Neuroinflammation is an essential mechanism involved in the pathogenesis of subarachnoid hemorrhage (SAH)-induced brain injury. Recently, Netrin-1 (NTN-1) is well established to exert anti-inflammatory property in non-nervous system diseases through inhibiting infiltration of neutrophil. The present study was designed to
Junhui Chen et al.
Journal of cellular and molecular medicine, 23(3), 2256-2262 (2019-01-08)
Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms
Bo Wang et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(5), 939-954 (2019-01-16)
Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Dan Liu et al.
BMC ophthalmology, 14, 102-102 (2014-08-26)
Netrin-1 has been reported to promote retinal neovascularization in oxygen-induced retinopathy (OIR). However, netrin-1 receptors, which may mediate netrin-1 action during retinal neovascularization, have not been characterized. In this study, we investigated netrin-1 receptor subtype expression and associated changes in

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica