Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU124231

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATC

Ensembl | Número de adesão de ser humano

ENSG00000159216

nº de adesão NCBI

NM_001001890

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RUNX1(861) , RUNX1(861)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FCV
QCS
YCU
IDS
KAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chenghao Lu et al.
Pathology, research and practice, 216(11), 153142-153142 (2020-09-01)
Colorectal cancer (CRC) was one of the most malignant tumors worldwide due to its metastasis. Epithelial-to-mesenchymal transition (EMT) plays an important role in CRC migration, and transforming growth factor-β (TGF-β) works as a dominating cytokine in CRC EMT process. Here
Siyuan Zhou et al.
Biochemical and biophysical research communications, 519(3), 620-625 (2019-09-22)
Renal tubular epithelial cells (RTECs) play pivotal roles in the innate immune response in kidneys. Dendritic cell specific intracellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN) functions as both the innate immune recognition receptor and the adhesion molecule. In our previous study
AHyun Choi et al.
Blood, 130(15), 1722-1733 (2017-08-10)
The gene encoding the RUNX1 transcription factor is mutated in a subset of T-cell acute lymphoblastic leukemia (T-ALL) patients, and RUNX1 mutations are associated with a poor prognosis. These mutations cluster in the DNA-binding Runt domain and are thought to
Tong Zhou et al.
EBioMedicine, 31, 217-225 (2018-05-16)
Renal fibrosis is widely considered a common mechanism leading to end-stage renal failure. Epithelial-to-mesenchymal transition (EMT) plays important roles in the pathogenesis of renal fibrosis. Runt-related transcription factor 1(RUNX1) plays a vital role in hematopoiesis via Endothelial-to-Hematopoietic Transition (EHT), a
Ken-ichi Takayama et al.
Oncotarget, 6(4), 2263-2276 (2014-12-30)
Androgen receptor (AR) signaling is essential for the development of prostate cancer. Here, we report that runt-related transcription factor (RUNX1) could be a key molecule for the androgen-dependence of prostate cancer. We found RUNX1 is a target of AR and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica