Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU123581

Sigma-Aldrich

MISSION® esiRNA

targeting human THPO

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCCTTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACCCAAAGCCCTGGTAAAAGGGATACACAGGACTGAAAAGGGAATCATTTTTCACTGTACATTATAAACCTTCAGAAGCTATTTTTTTAAGCTATCAGCAATACTCATCAGAGCAGCTAGCTCTTTGGTCTATTTTCTGCAGAAATTTGCAACTCACTGATTCTCTACATGCTCTTTTTCTGTGATAACTCTGCAAAGGCCTGGGCTGGCCTGGCAGTTGAACAGAGGGAGAGACTAACCTTGAGTCAGAAAACAGAGAAAGGGTAATTTCCTTTGCTTCAAATTCAAGGCCTTCCAACGCCCCCATCCCCTTTACTATCATTCTCAGTGGGACTCTGATCCC

Ensembl | Número de adesão de ser humano

ENSG00000090534

nº de adesão NCBI

NM_000460

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... THPO(7066) , THPO(7066)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ting Zou et al.
Cancer biomarkers : section A of Disease markers, 25(2), 133-139 (2018-11-20)
Long noncoding RNAs (LncRNAs) are involved in the occurrence and progression of human tumors including ovarian cancer (OC). Long noncoding RNA HOTTIP has been found to be involved in several human tumors development. However, the role of HOTTIP in OC
Hideo Otsuki et al.
The Prostate, 77(2), 222-233 (2016-10-04)
Leucine stimulates cancer cell proliferation through the mTOR pathway, therefore, inhibiting leucine transporters may be a novel therapeutic target for cancer. L-type amino acid transporter (LAT) 1, a Na LNCaP and DU145 and PC-3 cell lines were used as a
Bo Li et al.
Free radical research, 52(4), 390-401 (2018-02-06)
Substantial evidence indicates that the alteration of the cellular redox status is a critical factor involved in cell growth and death and results in tumourigenesis. Cancer cells have an efficient antioxidant system to counteract the increased generation of ROS. However
Bo-Wen Dai et al.
Journal of Cancer, 10(19), 4540-4551 (2019-09-19)
As a master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicate poor survival outcome. Therefore, we concentrate on elucidating the role of HOXC10 in progression of oral squamous cell
Jie Zhang et al.
Disease markers, 2019, 8964015-8964015 (2019-11-30)
Cyclin-dependent kinase regulatory subunit 2 (CKS2) is a member of the cell cycle-dependent protein kinase subunit family, which is implicated as an oncogene in various malignancies. However, the clinical significance, oncogenic functions, and related mechanisms of CKS2 in hepatocellular carcinoma
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica