Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU120531

Sigma-Aldrich

MISSION® esiRNA

targeting human USP22

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGACAACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTACACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACCAAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAGTTCCTGGAATACGAGTAGCCTTATCTGCAGCTGGTCAGAAAAACAAAGGCAATGCATTGGCAAGCCTCACAAAGT

Ensembl | Número de adesão de ser humano

ENSG00000124422

nº de adesão NCBI

NM_015276

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... USP22(23326) , USP22(23326)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IDV
XZU
ZYU
OWU
RUU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dongyeon Kim et al.
Journal of cellular physiology, 232(12), 3664-3676 (2017-02-06)
The proto-oncogene c-Myc has a pivotal function in growth control, differentiation, and apoptosis and is frequently affected in human cancer, including breast cancer. Ubiquitin-specific protease 22 (USP22), a member of the USP family of deubiquitinating enzymes (DUBs), mediates deubiquitination of
Gaojun Xu et al.
Experimental cell research, 362(2), 268-278 (2017-11-28)
MicroRNA-30e-5p (miR-30e-5p) is a tumor suppressor that is known to be downregulated in non-small cell lung cancer (NSCLC). However, how miR-30e-5p inhibits NSCLC tumorigenesis is not known. Ubiquitin-specific peptidase 22 (USP22) is upregulated in NSCLC and promotes tumorigenesis via a
An-Long Ji et al.
World journal of gastroenterology, 25(7), 824-836 (2019-02-28)
Intestinal ischemia reperfusion (I/R) injury is a serious but common pathophysiological process of many diseases, resulting in a high mortality rate in clinical practice. Ubiquitin-specific protease 22 (USP22) acts as regulator of cell cycle progression, proliferation, and tumor invasion. Depleted
Ying Lin et al.
Oncology letters, 20(5), 246-246 (2020-09-26)
Renal cell carcinoma (RCC) is one of the commonest urological tumors. The incidence of RCC ranks third among urological tumors, after prostate cancer and bladder tumors. However, the etiology of RCC remains unclear. Ubiquitin-specific protease 22 (USP22), a potential marker
R-Q Xin et al.
European review for medical and pharmacological sciences, 24(19), 9932-9939 (2020-10-23)
MicroRNA-329-3p (miR-329-3p) has been shown to be involved in tumor development. But its role in hepatocellular carcinoma has not been explored. Our study aims to explore the effect and mechanism of miR-329-3p on hepatocellular carcinoma development. Hepatocellular carcinoma tissues and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica