Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU116541

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK3, C8ORF44-SGK3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTATTGCCGAGATGTTGCTGAAATGTATGACAATATCCTTCACAAACCCCTAAGTTTGAGGCCAGGAGTGAGTCTTACAGCCTGGTCCATTCTGGAAGAACTCCTAGAAAAAGACAGGCAAAATCGACTTGGTGCCAAGGAAGACTTTCTTGAAATTCAGAATCATCCTTTTTTTGAATCACTCAGCTGGGCTGACCTTGTACAAAAGAAGATTCCACCACCATTTAATCCTAATGTGGCTGGACCAGATGATATCAGAAACTTTGACACAGCATTTACAGAAGAAACAGTTCCATATTCTGTGTGTGTATCTTCTGACTATTCTATAGTGAATGCCAGTGTATTGGAGGCAGATGATGCATTCGTTGGTTTCTCTTATGCACCTCCTTCAGAAGACTTATTTTTGTGAGCAGTTTGCCATTC

Ensembl | Número de adesão de ser humano

ENSG00000104205

nº de adesão NCBI

NM_170709

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SGK3(100533105) , SGK3(23678)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LYU
JUU
EES
RPR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuanzhong Wang et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(8), E1500-E1508 (2017-02-09)
Many estrogen receptor alpha (ERα)-positive breast cancers initially respond to aromatase inhibitors (AIs), but eventually acquire resistance. Here, we report that serum- and glucocorticoid-inducible kinase 3 (SGK3), a kinase transcriptionally regulated by ERα in breast cancer, sustains ERα signaling and
Laura Creevey et al.
Molecular cancer therapeutics, 18(10), 1731-1743 (2019-07-11)
Divergent roles for androgen receptor (AR) in breast cancer have been reported. Following aromatase inhibitor (AI) treatment, the conversion of circulating androgens into estrogens can be diminished by >99%. We wished to establish whether the steroid environment can dictate the
Shingo Miyata et al.
Biochemical and biophysical research communications, 464(1), 76-82 (2015-06-06)
Major depression, one of the most prevalent mental illnesses, is thought to be a multifactorial disease related to both genetic and environmental factors. However, the genes responsible for and the pathogenesis of major depression at the molecular level remain unclear.
Huailei Liu et al.
Journal of neuro-oncology, 122(3), 431-439 (2015-02-28)
Glioblastoma multiforme (GBM) is the most malignant brain tumor in humans. Previous studies have demonstrated that microRNA plays important roles in the development and proliferation of GBM cells. Here we defined the mechanism by which miR-212-3p regulated the proliferation of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica