Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU115611

Sigma-Aldrich

MISSION® esiRNA

targeting human NPM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA

Ensembl | Número de adesão de ser humano

ENSG00000181163

nº de adesão NCBI

NM_199185

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NPM1(4869) , NPM1(4869)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Qing-Qing Wang et al.
Chinese journal of cancer, 30(12), 853-860 (2011-11-22)
Nucleophosmin/B23 (NPM) is a universally expressed nucleolar phosphoprotein that participates in proliferation, apoptosis, ribosome assembly, and centrosome duplication; however, the role of NPM in cell cycle regulation is not well characterized. We investigated the mechanism by which NPM is involved
Laura Arnoldo et al.
Scientific reports, 5, 8552-8552 (2015-02-26)
High Mobility Group A are non-histone nuclear proteins that regulate chromatin plasticity and accessibility, playing an important role both in physiology and pathology. Their activity is controlled by transcriptional, post-transcriptional, and post-translational mechanisms. In this study we provide evidence for
L Lam et al.
Oncogenesis, 1, e4-e4 (2012-01-01)
Nucleophosmin (NPM) is a nucleolar phosphoprotein that is involved in many cellular processes and has both oncogenic and growth suppressing activities. NPM is localized primarily in nucleoli but shuttles between the nucleus and the cytoplasm, and sustained cytoplasmic distribution contributes
Dan Li et al.
The American journal of Chinese medicine, 45(3), 599-614 (2017-04-08)
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica