Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU113851

Sigma-Aldrich

MISSION® esiRNA

targeting human PABPC1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTCCTAAATGATCGCAAAGTATTTGTTGGACGATTTAAGTCTCGTAAAGAACGAGAAGCTGAACTTGGAGCTAGGGCAAAAGAATTCACCAATGTTTACATCAAGAATTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGATCTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACTGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCACAGAAAGCTGTGGATGAGATGAACGGAAAGGAGCTCAATGGAAAACAAATTTATGTTGGTCGAGCTCAGAAAAAGGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAACAGATGAAACAAGATAGGATCACCAGATACCAGGGTGTTAATCTTTATGTGAAAAATCTTGATGATGGTATTGATGATGAACGTCTCCGGAAAGAGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qiao Xue et al.
Pathogens (Basel, Switzerland), 9(6) (2020-06-10)
Seneca Valley Virus (SVV) is an oncolytic virus of the Picornaviridae family, which has emerged in recent years. The impact of SVV on host cell translation remains unknown. Here, we showed, for the first time, that SVV infection cleaved poly(A)
Xia Jiang et al.
PloS one, 9(7), e101993-e101993 (2014-07-08)
Despite the development and availability of hepatitis A virus (HAV) vaccine, HAV infection is still a major cause of acute hepatitis that occasionally leads to fatal liver disease. HAV internal ribosomal entry-site (IRES) is one of the attractive targets of
Nicola Guzzi et al.
Cell, 173(5), 1204-1216 (2018-04-10)
Pseudouridylation (Ψ) is the most abundant and widespread type of RNA epigenetic modification in living organisms; however, the biological role of Ψ remains poorly understood. Here, we show that a Ψ-driven posttranscriptional program steers translation control to impact stem cell commitment during

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica