Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU112661

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em15 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em15 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCT

Ensembl | Número de adesão de ser humano

ENSG00000176171

nº de adesão NCBI

NM_004052

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BNIP3(664) , BNIP3(664)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QWU
MDT
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xianjie Li et al.
International journal of molecular medicine, 46(2), 729-739 (2020-07-07)
Long non‑coding RNA (lncRNA) DGCR5 has been identified as a tumor suppressor in several types of cancer. However, its biological functions in pancreatic cancer (PaCa) have not yet been fully elucidated. The present study was designed to investigate the role
Zhiliang He et al.
Acta biochimica et biophysica Sinica, 49(1), 25-32 (2016-11-20)
Nutrition deficiency is reported to induce apoptosis of chondrocytes and degeneration of cartilage endplate (CEP) in rabbit. Cartilage endplate stem cells (CESCs) are important for the integrity of structure and function of CEP. Bcl-2/adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) has
Zong-Jie Fu et al.
Redox biology, 36, 101671-101671 (2020-08-24)
In the present study, we hypothesized that hypoxia-inducible factor 1α (HIF-1α)-mediated mitophagy plays a protective role in ischemia/reperfusion (I/R)-induced acute kidney injury (AKI). Mitophagy was evaluated by measuring the changes of mitophagy flux, mitochondria DNA copy number, and the changes
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Jie Liu et al.
Molecular medicine reports, 16(5), 7253-7260 (2017-09-26)
Nutrient deprivation (ND)‑induced nucleus pulposus (NP) cell death serves an important role in intervertebral disc degeneration disease. However, the underlying mechanisms have yet to be thoroughly elucidated. The present study created a cell culture model under ND conditions to investigate
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica