Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU109221

Sigma-Aldrich

MISSION® esiRNA

targeting human TARDBP

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAGAC

Ensembl | Número de adesão de ser humano

ENSG00000120948

nº de adesão NCBI

NM_007375

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TARDBP(23435) , TARDBP(23435)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaowei Chen et al.
Protein & cell, 9(10), 848-866 (2017-09-28)
Aberrant regulation of miRNA genes contributes to pathogenesis of a wide range of human diseases, including cancer. The TAR DNA binding protein 43 (TDP-43), a RNA/DNA binding protein associated with neurodegeneration, is involved in miRNA biogenesis. Here, we systematically examined
Seiichi Nagano et al.
Acta neuropathologica, 140(5), 695-713 (2020-08-18)
Mislocalization and abnormal deposition of TDP-43 into the cytoplasm (TDP-43 proteinopathy) is a hallmark in neurons of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the pathogenic mechanism of the diseases linked to TDP-43 is largely unknown. We
Michael E Ward et al.
The Journal of experimental medicine, 211(10), 1937-1945 (2014-08-27)
Frontotemporal dementia (FTD) is the most common cause of dementia in people under 60 yr of age and is pathologically associated with mislocalization of TAR DNA/RNA binding protein 43 (TDP-43) in approximately half of cases (FLTD-TDP). Mutations in the gene
Alexander Gulliver Bjørnholt Grønning et al.
Nucleic acids research, 48(13), 7099-7118 (2020-06-20)
Nucleotide variants can cause functional changes by altering protein-RNA binding in various ways that are not easy to predict. This can affect processes such as splicing, nuclear shuttling, and stability of the transcript. Therefore, correct modeling of protein-RNA binding is
Stephani A Davis et al.
Neurobiology of disease, 103, 154-162 (2017-04-19)
Although the main focus in Alzheimer's disease (AD) has been an investigation of mechanisms causing Aβ plaque deposition and tau tangle formation, recent studies have shown that phosphorylated TDP-43 pathology is present in up to 50% of sporadic cases. Furthermore
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica