Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU108281

Sigma-Aldrich

MISSION® esiRNA

targeting human MCTS1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTCCGATGCCATGAACATATAGAAATCCTTACAGTAAATGGAGAATTACTCTTTTTTAGACAAAGAGAAGGGCCTTTTTATCCAACCCTAAGATTACTTCACAAATATCCTTTTATCCTGCCACACCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCAGGCTTAACTTCTCCTGGAGCTAAGCTTTACCCTGCTGCAGTAGATACCATTGTTGCTATCATGGCAGAAGGAAAACAGCATGCTCTATGTGTTGGAGTCATGAAGATGTCTGCAGAAGACATTGAGAAAGTCAACAAAGGAATTGGCATTGAAAATATCCATTATTTAAATGATGGGCTGTGGCATATGAAGACATATAAATGAGCCTCAGAAGGAATGCACTTGGGCTA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Cassidy C Daw et al.
Cell, 183(2), 474-489 (2020-10-10)
Mg2+ is the most abundant divalent cation in metazoans and an essential cofactor for ATP, nucleic acids, and countless metabolic enzymes. To understand how the spatio-temporal dynamics of intracellular Mg2+ (iMg2+) are integrated into cellular signaling, we implemented a comprehensive
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica