Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU105721

Sigma-Aldrich

MISSION® esiRNA

targeting human PCNA

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Amy Kwan et al.
Molecular cancer therapeutics, 20(3), 589-601 (2020-12-11)
Oncolytic viruses (OV) have been shown to activate the antitumor functions of specific immune cells like T cells. Here, we show OV can also reprogram tumor-associated macrophage (TAM) to a less immunosuppressive phenotype. Syngeneic, immunocompetent mouse models of primary breast
Keiichiro Sakuma et al.
Cancer science, 109(8), 2458-2468 (2018-06-06)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL), an RNA-binding protein that regulates alternative splicing of pre-mRNA, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here, we show that HNRNPLL promotes cell cycle progression and
Wanwan Jia et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 4031-4042 (2018-02-27)
Rheumatoid arthritis (RA) is an immune-mediated disease with the characteristics of progressive joint destruction, deformity, and disability. Epigenetic changes have been implicated in the development of some autoimmune disorders, resulting in an alteration of gene transcription. Here, we investigated how
N Kanu et al.
Oncogene, 35(30), 4009-4019 (2015-11-10)
The DNA replication machinery invariably encounters obstacles that slow replication fork progression, and threaten to prevent complete replication and faithful segregation of sister chromatids. The resulting replication stress activates ATR, the major kinase involved in resolving impaired DNA replication. In
Joachim Garbrecht et al.
Nucleus (Austin, Tex.), 9(1), 474-491 (2018-09-13)
Fluorescence microscopy in combination with the induction of localized DNA damage using focused light beams has played a major role in the study of protein recruitment kinetics to DNA damage sites in recent years. Currently published methods are dedicated to

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica