Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU105041

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em30 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTGGGTGAAGAATGGAAGGGTTATGTGGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCAGGGTGTCTTGACCCATGGCCGTGTCCGCCTGCTACTGAGTAAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAGAAAGAAAGAGAAAATCAGTTCGTGGTTGCATTGTGGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAAAAAAGGAGAGAAGGATATTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTGGGCCCCAAAAGAGCTAGCAGAATCCGCAAACTTTTCAATCTCTCTAAAGAAGATGATGTCCGCCAGTATGTTGTAAGAAAGCCCTTAAATAAAGAAGGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTGCAG

Ensembl | Número de adesão de ser humano

ENSG00000137154

nº de adesão NCBI

NM_001010

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RPS6(6194) , RPS6(6194)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PXT
QAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yun Zou et al.
Oncotarget, 8(13), 20825-20833 (2017-02-18)
Renal cell carcinoma (RCC) is a urologic malignant cancer and often diagnosed at an advanced stage, which results in high mortality. Targeted therapy may improve the quality of life and survival of patients who are not suitable for nephrectomy. Everolimus
Atsuko Tsukimoto et al.
Antiviral research, 117, 1-9 (2015-02-11)
Previous studies have demonstrated that cyclopentenone prostaglandins (cyPGs) inhibit the replication of a wide variety of DNA and RNA viruses in different mammalian cell types. We investigated a new role for prostaglandin A1 (PGA1) in the inhibition of hepatitis C
Lingqin Yuan et al.
Endocrine-related cancer, 22(4), 577-591 (2015-06-06)
Glutamine is one of the main nutrients used by tumor cells for biosynthesis. Therefore, targeted inhibition of glutamine metabolism may have anti-tumorigenic implications. In the present study, we aimed to evaluate the effects of glutamine on ovarian cancer cell growth.

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica