Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU100781

Sigma-Aldrich

MISSION® esiRNA

targeting human SREBF2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCGCTCCTCCATCAATGACAAAATCATCGAATTGAAAGACCTGGTCATGGGGACAGACGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATACTTGCAGCAGGTCAATCATAAACTGCGCCAGGAGAACATGGTGCTGAAGCTGGCAAATCAAAAGAACAAGCTTCTAAAGGGCATCGACCTAGGCAGTCTGGTGGACAATGAGGTGGACCT

Ensembl | Número de adesão de ser humano

ENSG00000198911

nº de adesão NCBI

NM_004599

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SREBF2(6721) , SREBF2(6721)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FMU
HRS
QCS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Silvia Cetrullo et al.
Cells, 9(3) (2020-03-01)
While high levels of saturated fatty acids are associated with impairment of cardiovascular functions, n-3 polyunsaturated fatty acids (PUFAs) have been shown to exert protective effects. However the molecular mechanisms underlying this evidence are not completely understood. In the present
Demin Cai et al.
Nature communications, 10(1), 4621-4621 (2019-10-13)
Tumor subtype-specific metabolic reprogrammers could serve as targets of therapeutic intervention. Here we show that triple-negative breast cancer (TNBC) exhibits a hyper-activated cholesterol-biosynthesis program that is strongly linked to nuclear receptor RORγ, compared to estrogen receptor-positive breast cancer. Genetic and
Johan Fernø et al.
BMC neuroscience, 7, 69-69 (2006-10-21)
The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse
Paul Lebeau et al.
The Journal of biological chemistry, 292(4), 1510-1523 (2016-12-03)
Accumulating evidence implicates endoplasmic reticulum (ER) stress as a mediator of impaired lipid metabolism, thereby contributing to fatty liver disease and atherosclerosis. Previous studies demonstrated that ER stress can activate the sterol regulatory element-binding protein-2 (SREBP2), an ER-localized transcription factor
Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica