Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU099881

Sigma-Aldrich

MISSION® esiRNA

targeting human FN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTC

Ensembl | Número de adesão de ser humano

ENSG00000115414

nº de adesão NCBI

NM_212474

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FN1(2335) , FN1(2335)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
UTU
WRU
UPU
QCS
KXT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Seth P Zimmerman et al.
Journal of cell science, 130(18), 2971-2983 (2017-07-30)
Rho GTPase family members are known regulators of directed migration and therefore play key roles in processes including development, the immune response and cancer metastasis. However, their individual contributions to these processes are complex. Here, we modify the activity of
Najla El-Hachem et al.
Cell death and differentiation, 25(11), 2010-2022 (2018-03-09)
HACE1 is an E3 ubiquitin ligase described as a tumour suppressor because HACE1-knockout mice develop multi-organ, late-onset cancers and because HACE1 expression is lost in several neoplasms, such as Wilms' tumours and colorectal cancer. However, a search of public databases
Wenzhong Yi et al.
Oncology reports, 36(6), 3145-3153 (2016-10-18)
Fibronectin is a glycoprotein of the extracellular matrix, and regulates the processes of self-renewal and cell cycle progression. This study aimed to investigate fibronectin expression in colorectal cancer (CRC) and elucidate the effects of fibronectin on CRC by using a
Shuye Yu et al.
Oncogene, 39(27), 5042-5055 (2020-06-11)
Guanylate-binding protein 2 (GBP2) is an interferon-inducible large GTPase which is crucial to the protective immunity against microorganisms. However, its biological function in cancer remains largely unknown. Glioblastoma multiforme (GBM) is the most common and deadly brain tumor in adults.
Changgeng Xu et al.
Molecular medicine reports, 13(1), 901-908 (2015-12-10)
Lefty is a member of the transforming growth factor (TGF) β superfamily, which is implicated in left‑right patterning during embryogenesis. Previous studies revealed that lefty attenuates the epithelial‑mesenchymal transition in tubular epithelial cells. In the present study, the protective effect
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica