Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU099351

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em17 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em17 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG

Ensembl | Número de adesão de ser humano

ENSG00000170312

nº de adesão NCBI

NM_033379

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDK1(983) , CDC2(983)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BBV
SAV
TYU
JUU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jiajia Li et al.
Biochemical and biophysical research communications, 523(2), 434-440 (2019-12-27)
Ovarian cancer is the most lethal gynecological malignancy, but the mechanisms of ovarian cancer progression and cisplatin resistance remain unclear. Emerging evidence suggested that ubiquitin-conjugating enzyme E2C (UBE2C) was highly expressed in a variety of tumors and acted as an
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica