Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU095241

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR3 (1)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGTGCAGGTTCCGATGTTATTAGATGTTACAAGTTTATATATATCTATATATATAATTTATTGAGTTTTTACAAGATGTATTTGTTGTAGACTTAACACTTCTTACGCAATGCTTCTAGAGTTTTATAGCCTGGACTGCTACCTTTCAAAGCTTGGAGGGAAGCCGTGAATTCAGTTGGTTCGTTCTGTACTGTTACTGGGCCCTGAGTCTGGGCAGCTGTCCCTTGCTTGCCTGCAGGGCCATGGCTCAGGGTGGTCTCTTCTTGGGGCCCAGTGCATGGTGGCCAGAGGTGTCACCCAAACCG

Ensembl | Número de adesão de ser humano

ENSG00000068078

nº de adesão NCBI

NM_000142

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FGFR3(2261) , FGFR3(2261)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Josine M Quispel-Janssen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 84-94 (2017-10-25)
Purpose: Despite intense research, treatment options for patients with mesothelioma are limited and offer only modest survival advantage. We screened a large panel of compounds in multiple mesothelioma models and correlated sensitivity with a range of molecular features to detect
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
Xina Xie et al.
Experimental and therapeutic medicine, 18(2), 1226-1234 (2019-07-19)
Fibroblast growth factor receptor 3 (FGFR3) is a high frequency mutant gene in bladder cancer (BCa) and has become a promising therapeutic target due to its involvement in cell proliferation and migration. However, whether and how FGFR3 mutations affects BCa
Takeshi Okada et al.
Molecular neurobiology, 56(12), 8203-8219 (2019-06-17)
Neuronal apoptosis is a common and critical pathology following subarachnoid hemorrhage (SAH). We investigated the anti-apoptotic property of fibroblast growth factor (FGF)-2 after SAH in rats. A total of 289 rats underwent endovascular perforation to induce SAH or sham operation.
V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica