Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU094941

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPD (1)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGA

Ensembl | Número de adesão de ser humano

ENSG00000138668

nº de adesão NCBI

NM_031369

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HNRNPD(3184) , HNRNPD(3184)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shuhong Sun et al.
The Journal of biological chemistry, 291(50), 25823-25836 (2016-10-28)
Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes
Luigi Alfano et al.
Nucleic acids research, 47(8), 4068-4085 (2019-02-26)
DNA double strand break (DSB) repair through homologous recombination (HR) is crucial to maintain genome stability. DSB resection generates a single strand DNA intermediate, which is crucial for the HR process. We used a synthetic DNA structure, mimicking a resection
Huiwen Song et al.
Autophagy, 15(8), 1419-1437 (2019-03-15)
N6-methyladenosine (m6A) mRNA modifications play critical roles in various biological processes. However, no study addresses the role of m6A in macroautophagy/autophagy. Here, we show that m6A modifications are increased in H/R-treated cardiomyocytes and ischemia/reperfusion (I/R)-treated mice heart. We found that

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica