Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092651

Sigma-Aldrich

MISSION® esiRNA

targeting human ACACA (1)

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em19 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em19 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAGGGTGCGTTTCAATCAGATGCTTCTGGAACGTCGAAATTGTCTTCTTTGGAAAGAACCATCCCCTCTTTGGGCTTCAGAGGCCCAAATTGAGGCGCAATGATGAGAGGATGTGGTGGTCTACTCTGATGTCAATCTTGAGGGCTAGGTCTTTCTGGAAGTGGATATCTACTCAGACAGTAAGAATTATAAGAGCTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCAGCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGG

Ensembl | Número de adesão de ser humano

ENSG00000132142

nº de adesão NCBI

NM_198837

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ACACA(31) , ACACA(31)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
SRT
ERT
HES

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Maosong Ye et al.
Journal of thoracic disease, 8(8), 1943-1955 (2016-09-14)
Lung cancer is the leading cause of cancer-related death worldwide. Patients with lung cancer are very frequently present with pulmonary infections, in particular with Gram-negative bacteria. Herein, we investigated the effect of the co-presence of Gram-negative bacteria on outgrowth and
Bingyu Ye et al.
Molecular medicine reports, 19(5), 3431-3440 (2019-03-01)
Acetyl‑coenzyme A carboxylase 1 (ACC1) serves a major role in fatty acid synthesis. Previous reports have indicated that ACC1 is a promising drug target for treating human diseases, particularly cancers and metabolic diseases; however, the role of ACC1 in liver
Wenjuan Li et al.
Molecular carcinogenesis, 55(11), 1739-1746 (2015-10-17)
Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica